1. Select only ONE of the following environmental stresses: (a) heat, (b) high levels of solar radiation, (c) cold, or (d) high altitude. Discuss specifically how this environmental stress negatively impacts the survival of humans by disturbing homeostasis.

 High Levels of solar radiation can negatively impact humans by disturbing our homeostasis and altering our ability to survive. When radiation occurs from solar storms in space, these storms produce waves of radiation rays. For example UVA rays are able to penetrate through the epidermis layer of human skin and affect the dermis layer, causing defects in human cells. Other rays such as UVB rays are also produced and strictly affect the epidermis layer of the skin again causing cell deformation and causing skin cancer which is harmful to our stability and balance.  The human body has a negative reaction to high levels of solar radiation.  

2. Identify 4 ways in which humans have adapted to this stress, choosing one specific adaptation from each of the different types of adaptations listed above (short term, facultative, developmental and cultural). Include images of the adaptations.

                Short Term response: When Humans are exposed to high levels of radiation, for example, being at the beach to long exposed to the suns UV rays causing your skin to burn and turn red and feel raw.  This is also a warning reaction that the body produces to warn you of the harmful exposure. Level of melanin that a human produces is also responsible for how much a person can withstand being exposed to these harmful rays such as UVA / UVB before experiencing severe damage the skin cells.

 

Facultative: Have you ever notice that in the summer time humans tend to be a little more on the tan side, and during the winter months people tend to be more pale and white. Well this is because the body is responding to environmental stresses. In the summer months humans tend to be outside more than in the winter, so we expose ourselves to the UV rays produced by the sun. When these rays are absorb in great amounts it causes skin cells to become defective. When the human skin becomes tanner it is producing a sunscreen that will remain until we remove this environmental stress. Tanner skin protects our skin and keeps us from absorbing too much of the UVA/UVB rays that can cause skin cells to become defective.

 

                Developmental:  Developmental changes are found in populations that have been subjected to a large amount of solar radiation there for their skin color has become dark to help shield themselves for an over absorption  of UV rays. An example of this is people who live in the Savannah’s of Africa, they are dark skin and able to withstand higher levels of solar radiation exposure. There is a proven correlation between people’s skin color and living environments.

Cultural:  A cultural adaptation to a harmful UV rays have been examples like wearing clothing that protects you from the environmental stress, we have also developed sunscreen cream that we can use to help protect our skin from UV rays penetrating, and also creating shelters that help us cover ourselves and protect us from harsh exposure to environmental stresses.  Also migration can play a role, by fleeing one site in order to survive during a certain season and then returning back during the prime seasons.

3. What are the benefits of studying human variation from this perspective across environmental clines? Can information from explorations like this be useful to help us in any way? Offer one example of how this information can be used in a productive way.

             The benefits of studying human variation is to understand how humans have adapted and altered to be able to exist and protect themselves from harsh environmental stress imposed by mother nature. We can see how population have migrated or developed traits to endure the environmental stresses.  We can look back and see how humans have evolved throughout the years and adapted.  This information can give us insight about who we are today and why we have developed certain traits.  We can understand how important some of our traits are to our human existence and how populations survived.  By studying skin cancer and UV rays, we can determine what levels are acceptable to the human body and what levels are need to survive in order for the body to produce the proper levels of vitamin D.

4. How would you use race to understand the variation of the adaptations you listed in #2? Explain why the study of environmental influences on adaptations is a better way to understand human variation than by the use of race.

                 I would use race to help determine geographical location of populations so I can analyze the human traits according to the environmental stress they were or are exposed to.  This will also help with understanding their ancestral traits and be able to keep track of when population may have migrated due to harsh environmental stresses.  When studying environmental influences of populations over a long period of time, we start to notice patterns that develop due to the exposure of a not normal environmental condition that cause traits to alter and change in order to adapt to the new environmental conditional. Thus we can see when certain populations have migrated in order to keep alive by finding other geographical locations that then subject themselves to a different kind of environmental stress which causes the body to change and evolve traits to better adapt to the new and less harsh environment.  We can actually acknowledge these changes and verify that certain traits have been developed due to a change in environmental influences.

Piltdown Hoax

          The Piltdown hoax is one f the most famous frauds in the history of science. In 1912 Charles Dawson, discovered the first of two skulls found in the Piltdown quarry in Sussex, England, skulls of an apparently primitive hominid, and ancestor of man. These fossils were called Piltdown Man or the scientific name, " eoanthropus dawsoni", was a spectacular find, because it was expected to be the missing link between a mixture of human and ape with the noble brow of Homo sapiens and a primitive jaw. The most interesting fact that would of been shocking is that the fossils appeared to be British decent. The reactions to the find was mixed. The announcement of the find at Pildown caused a great stir in both public and scientific circles. The newspapers and the public imagination were fascinated by the idea of the missing link and the find instantly gained importance because it was so popular. There were several supporters from the scientific community, mostly British.  Scientist were in a competition with scientist in Europe. They wanted a significant find in order to establish Britain's paleontological community. Scientist in other countries were skeptical of the remains. Many believed that this was merely the jaw of an ape and the skull of a human, brought together by accidental placement. The features simply did not fit with the rest of what was begin discovered increasingly more around the world. In 1949 a test was applied to the Pitdown fossils and they were found to be no more that 600 years old. Even so the test was new and did not immediately give rise to suspicion. Many scientist doubted the accuracy of the technology used. JS Wiener was a professor oh physical anthropology at Oxford. He had long believed that the Piltdown bones were from two different species. Wiener has also questions the exact location that the fossils were found, and now one could give a certain answer of a exact location, which is a staggering lapse for any paleontologist who discovered a new fossil. Wiener found this to be curious that the exact location was not documented. Weenier examined the original fossils, The evidence of forgery was immediately obvious. The teeth had been worn in the wrong direction. A glance through a microscope instantly revealed regular, crosshatched abrasion patterns, which is a sure sign of the work of a file. Wiener compared the Piltdown teeth to a chimpanzee teeth that he filed down himself, and found the markings identical. The bones had been coated with a solution of iron to give them an aged look, but upon drilling beneath the surface the teeth were found to be pure white. More test were done by Sir Kenneth Oakley who found the following: Piltdown skull was of a medieval man 60 years ago, the jawbone was of a Orangutan jaw 500 years ago, the molar was of a Elephant and the teeth were from a Hippopotamus. Reaction among scientist was immediate. Most were relieved at last, no one had to try to make the Piltdown fit with the rest of the fossil record, and impossible task which many had already tried accomplishing but could not.

          The Piltdown man fraud significantly impacted early research on human evolution. It led scientist down a blind alley in the belief that the human brain expanded in size before the jaw adapted to new types of food. Discoveries in the 1920's in South Africa were ignored because of Piltdown man, and the reconstruction of human evolution was confused for decades. The Piltdown case is a good example of how popularity, competitiveness, and bias thoughts can shape science in the wrong way. Piltdown was most likely a deliberate hoax. I think that the human faults came into play because who ever decided to produce the hoax didn't think that the fossils would ever be tested to the extent that they were. I think the who ever is responsible for this hoax also banked on their credentials. The two men who discovered the Piltdown man thought they could hide their alterations because who would question them. This is a problem with science today, that people sometimes feel intimidated to question people that hold such great credentials. The negative impact that it has on the science field is that this hoax made it harder for the public to believe anything after the Piltdown hoax because people didn't have the technology to trust the information present to prove the finding correct through experiments. Even though 40 years after the discover they fossils were finally proven the hoax through fluorine absorption technique, it still leaves a bad taste in the public mouth. Another fault is that I think the British scientist were looking to put themselves on the map of show that they have discovered something no one else has, trying to boos their credibility across the world. What was good is that scientist from around the world disagreed time and time again, which lead to constant testing, that proved a false species.

          In 1953, it was published by Kenneth Oakley, Wilfrid Edward and Joseph Wiener proving that the Piltdown man was a forgery and demonstrating that the fossil was composite of three distinct species. It consisted of human skull of medieval age, the 500 year old lower jaw was a orangutan and chimpanzee fossil teeth. The appearance of age had been created by staining the bones with an iron solution and chromatic acid. Microscopic examination revealed file marks on the teeth in the wrong direction, and from that it was developed that someone had altered or modified the teeth to give them a shape more suited to a human diet. Chemical studies found the fossil to be less than 50,000 years old, not 1 million years as Dawson and Woodward claimed.

          I don't think it is possible to ever remove the "human factor", from science to reduce the chance of error. I think its the nature of the beast, that humans will always have flaws or want something they cant have like in this Piltdown Hoax. I seriously think the scientist were looking for some kind of recognition and to be famous. As technologies evolves we can prove more and more if something is a hoax. Also with so many scientist in the field, you have to prove your self correct and when the majority of the science field are not agreeing on something, this is a sign that something may be wrong or altered.  I don't think you would want to remove the human factor from science because the benefits out way the costs. Sometimes people mistakenly discover new bones or archaeological sites by human fault. Then we test the findings to compare them to other findings that have been tested the same way. When the experiments match then we can feel 95% confident that what we have is true. I also think as humans evolve and the technological advances, it will weed out the bad science that may exist, or that  had been suggested because someone had been idolized by the science field. This is what is great about human nature, we are always seeking for the truth, and when the truth is altered we usually expose it because something doesn't line up with previous experiments or theories or evidence.

          Never take information at face value, it will always lead you down the wrong path. You must always look deeper into the truth expressed by others and determine if it really matches the facts.  Just because some one holds a high ranking position it doesn't always mean they are right. Again this is why I relay on experiments and comparing experiments to others who have conducted the same experiments to insure the outcome is the same. In the Pildwon hoax, scientist from around the world disagreed with the scientist from Britain, but didn't have the courage to stand up to them. Thus letting the information provided by the hoax distorted human evolution for years, sending scientist in a spiral loop that didn't make any sense. When this happens people need to really look at the facts and not let people with big names push around their weight. If your truly interested in the truth or determining the truth you will bring it to an experiment or testing. When experiments and testing cant help you, you must look at the past experiments and analyze were does your truth fit in, if it can truly fit in to the order of life. So when the puzzle is coming together and then you stubble across a piece that just doesn't fit, you test it and examine it over and over until your 100% sure the peice wont fit. Your throw that peice away and start over with a new one.

Analogous traits between and Human and Octopus

In comparing two different species such as, a human Eye and an Octopus Eye we find analogous traits. A human is what we call a land dweller, and live its whole life on the land. Octopuses are from the sea and live their whole life underwater. Both a human and octopus share different diets and different environmental stresses. The octopus and the human are not closely related and reside far away from each other on the phylogenetic tree of life. The eye of a human is very similar in structure to the eye of the octopus. In fact, the octopus eye is superior to the human eye in that it does not have a "blind spot". The diagram below shows the similarities of evolutional structures between the two eyes of a human and octopus. Both eyes are round and have the same structural traits. Both have an eyelid, cornea, pupil, iris, ciliary muscle, lens, retina, optic nerve and optic ganglion. Being that both of these species are far different from each other, it is amazing that they have developed such a unique trait that is very similar to each other. Both use the eye to visualize predators and stay away from danger. The human eye and octopus eye are used to hunt for prey in two different environment s. Being deep underwater the Octopus must be able to see in dark to little light habitats, while the humans must be able to see in bright habitats in order to survive.  This can be the reason why both species developed an eye to help advance its survival in habitats they live in. I would assume that many years ago the specie that was the common ancestor between the octopus and human had analogous traits. The specie had to of, because when the ancestral organisms split and down the path of evolving into humans or octopus the ability to develop eyeballs followed each new organisms this obtaining analogous traits between two separate species that are different in habitat, diet, and environmental stresses.

Homologous Traits, between a Human Arm and Dolphin pectoral fin.

In comparing two different species, such as a Human and a Bottlenose dolphin, we can find homologous traits. A Bottlenose dolphin is found living in the ocean, all around the world. They are mammals who venture the sea. Humans of course we know are mammals but live there life on land, crawling and then walking.  The human and dolphin come from two different habitats, they eat different diets, and are exposed to different evolutionary hurtles. The Bottlenose dolphin and the human share the same bone structure and formation with in their extended limbs. When you look at a dolphins fin and compare it to a humans arm, we see two different looking limbs. When you examine further you can see the similarities that are homologous traits. In the chart below you can see the traits that are alike, the phalanges, carpals, ulna, and radius and humerus bone fragments exist in each limb of a human and dolphin. The bones may be smaller or shaped differently between humans and dolphins because of the types of environments each animal lives in. The function of the each limb is used to complete different task or used for different methods of survival. The dolphin’s pectoral flipper is used for steering and carving through the water to make fast turns while using their back flipper to push them forward. Dolphins also use there flipper to touch and feel other dolphins for communication purposes. Humans use their arms for many tasks, such as climbing a rock structure that may be in one’s way. We also use our arms to throw weapons that will allow us to hunt and gather food. The different functions between the flipper and arm is important, we can see how the function has morphed each bone structure in the humans and dolphins limbs. The human has skinny phalanges and are shorter in comparison to the phalanges of a dolphin. The dolphins bone structure appears to be more compact and has a shorter humerus bone, pulling the flipper closer to the body. The humerus on a human is much longer extending the reach of the limb enabling a grab function. So the dolphin flipper is much more compact compare to a humans arm, but the structures are similar and that they contain similar bone placement with in the limb. Humans and Dolphins must have shared a common ancestor millions of years ago, the two species share common traits in limb placement and development. At one time the dolphin must have moved around on land slowly adapting to the ocean life over the years.  Humans must have adapted from crawling to walking allowing more use of the arm.  Homologous traits tell us that two different species have the same traits, but utilize the function of that trait differently, to adapt to the living environment. Thus human arms and dolphins fins show a perfect example of this explanation.

DNA molecule:

AGGTTACACCTGTATAATTTCAGAAGCCAACGTCAGTGTTAGCTGAATCTGTG